ID: 1034687396

View in Genome Browser
Species Human (GRCh38)
Location 7:152984955-152984977
Sequence TTATGAGGACACTAGTCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034687392_1034687396 -7 Left 1034687392 7:152984939-152984961 CCAATTGTCTCTCTCCTTATGAG No data
Right 1034687396 7:152984955-152984977 TTATGAGGACACTAGTCAGGCGG No data
1034687390_1034687396 14 Left 1034687390 7:152984918-152984940 CCTGTGTATTTGTCTCTGCCTCC No data
Right 1034687396 7:152984955-152984977 TTATGAGGACACTAGTCAGGCGG No data
1034687391_1034687396 -4 Left 1034687391 7:152984936-152984958 CCTCCAATTGTCTCTCTCCTTAT No data
Right 1034687396 7:152984955-152984977 TTATGAGGACACTAGTCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034687396 Original CRISPR TTATGAGGACACTAGTCAGG CGG Intergenic
No off target data available for this crispr