ID: 1034688400

View in Genome Browser
Species Human (GRCh38)
Location 7:152994493-152994515
Sequence GCTTCCTGGTTAGAAGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034688396_1034688400 10 Left 1034688396 7:152994460-152994482 CCAAGGCTGTCCAAGGAGCAGCT No data
Right 1034688400 7:152994493-152994515 GCTTCCTGGTTAGAAGGAACAGG No data
1034688395_1034688400 14 Left 1034688395 7:152994456-152994478 CCAACCAAGGCTGTCCAAGGAGC No data
Right 1034688400 7:152994493-152994515 GCTTCCTGGTTAGAAGGAACAGG No data
1034688397_1034688400 0 Left 1034688397 7:152994470-152994492 CCAAGGAGCAGCTGTTAGAAGAA No data
Right 1034688400 7:152994493-152994515 GCTTCCTGGTTAGAAGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034688400 Original CRISPR GCTTCCTGGTTAGAAGGAAC AGG Intergenic
No off target data available for this crispr