ID: 1034692441

View in Genome Browser
Species Human (GRCh38)
Location 7:153024491-153024513
Sequence CCAGCTACAAGGGTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034692429_1034692441 20 Left 1034692429 7:153024448-153024470 CCTCTCTCTCTCTCACCACCCAG No data
Right 1034692441 7:153024491-153024513 CCAGCTACAAGGGTGGAGCTGGG No data
1034692435_1034692441 -10 Left 1034692435 7:153024478-153024500 CCAGACACTTCTTCCAGCTACAA No data
Right 1034692441 7:153024491-153024513 CCAGCTACAAGGGTGGAGCTGGG No data
1034692432_1034692441 1 Left 1034692432 7:153024467-153024489 CCAGCTGCCTCCCAGACACTTCT No data
Right 1034692441 7:153024491-153024513 CCAGCTACAAGGGTGGAGCTGGG No data
1034692431_1034692441 2 Left 1034692431 7:153024466-153024488 CCCAGCTGCCTCCCAGACACTTC No data
Right 1034692441 7:153024491-153024513 CCAGCTACAAGGGTGGAGCTGGG No data
1034692433_1034692441 -6 Left 1034692433 7:153024474-153024496 CCTCCCAGACACTTCTTCCAGCT No data
Right 1034692441 7:153024491-153024513 CCAGCTACAAGGGTGGAGCTGGG No data
1034692427_1034692441 26 Left 1034692427 7:153024442-153024464 CCCTCTCCTCTCTCTCTCTCACC No data
Right 1034692441 7:153024491-153024513 CCAGCTACAAGGGTGGAGCTGGG No data
1034692428_1034692441 25 Left 1034692428 7:153024443-153024465 CCTCTCCTCTCTCTCTCTCACCA No data
Right 1034692441 7:153024491-153024513 CCAGCTACAAGGGTGGAGCTGGG No data
1034692430_1034692441 5 Left 1034692430 7:153024463-153024485 CCACCCAGCTGCCTCCCAGACAC No data
Right 1034692441 7:153024491-153024513 CCAGCTACAAGGGTGGAGCTGGG No data
1034692434_1034692441 -9 Left 1034692434 7:153024477-153024499 CCCAGACACTTCTTCCAGCTACA No data
Right 1034692441 7:153024491-153024513 CCAGCTACAAGGGTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034692441 Original CRISPR CCAGCTACAAGGGTGGAGCT GGG Intergenic
No off target data available for this crispr