ID: 1034694213

View in Genome Browser
Species Human (GRCh38)
Location 7:153039661-153039683
Sequence GGAAGCCACAAATGTCACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034694207_1034694213 24 Left 1034694207 7:153039614-153039636 CCTGGTGGAGGGGATGACAAGAA No data
Right 1034694213 7:153039661-153039683 GGAAGCCACAAATGTCACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034694213 Original CRISPR GGAAGCCACAAATGTCACTA TGG Intergenic
No off target data available for this crispr