ID: 1034694312

View in Genome Browser
Species Human (GRCh38)
Location 7:153040478-153040500
Sequence CGCACAGATGAACCTAGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034694312_1034694315 5 Left 1034694312 7:153040478-153040500 CCTAGGCTAGGTTCATCTGTGCG No data
Right 1034694315 7:153040506-153040528 CGTTCAGCCCCACTGCGAGGAGG No data
1034694312_1034694318 11 Left 1034694312 7:153040478-153040500 CCTAGGCTAGGTTCATCTGTGCG No data
Right 1034694318 7:153040512-153040534 GCCCCACTGCGAGGAGGCAGGGG No data
1034694312_1034694316 9 Left 1034694312 7:153040478-153040500 CCTAGGCTAGGTTCATCTGTGCG No data
Right 1034694316 7:153040510-153040532 CAGCCCCACTGCGAGGAGGCAGG No data
1034694312_1034694317 10 Left 1034694312 7:153040478-153040500 CCTAGGCTAGGTTCATCTGTGCG No data
Right 1034694317 7:153040511-153040533 AGCCCCACTGCGAGGAGGCAGGG No data
1034694312_1034694314 2 Left 1034694312 7:153040478-153040500 CCTAGGCTAGGTTCATCTGTGCG No data
Right 1034694314 7:153040503-153040525 ATTCGTTCAGCCCCACTGCGAGG No data
1034694312_1034694322 24 Left 1034694312 7:153040478-153040500 CCTAGGCTAGGTTCATCTGTGCG No data
Right 1034694322 7:153040525-153040547 GAGGCAGGGGTGATGCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034694312 Original CRISPR CGCACAGATGAACCTAGCCT AGG (reversed) Intergenic
No off target data available for this crispr