ID: 1034696077

View in Genome Browser
Species Human (GRCh38)
Location 7:153055053-153055075
Sequence TTGGATATGGTGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034696069_1034696077 22 Left 1034696069 7:153055008-153055030 CCTGTGATCTTCTCATTGTGTGG No data
Right 1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034696077 Original CRISPR TTGGATATGGTGAAGGAGGA GGG Intergenic
No off target data available for this crispr