ID: 1034696329

View in Genome Browser
Species Human (GRCh38)
Location 7:153057259-153057281
Sequence AGTGATCATAAAAAAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034696328_1034696329 15 Left 1034696328 7:153057221-153057243 CCATTTAATTAAAGAGAGAAGGA No data
Right 1034696329 7:153057259-153057281 AGTGATCATAAAAAAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034696329 Original CRISPR AGTGATCATAAAAAAGATGA AGG Intergenic
No off target data available for this crispr