ID: 1034697642

View in Genome Browser
Species Human (GRCh38)
Location 7:153068157-153068179
Sequence CTGCAGAAGAGGAAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034697636_1034697642 4 Left 1034697636 7:153068130-153068152 CCTAGACCTCAAAGAAAGCATAC No data
Right 1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG No data
1034697637_1034697642 -2 Left 1034697637 7:153068136-153068158 CCTCAAAGAAAGCATACCCTACT No data
Right 1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034697642 Original CRISPR CTGCAGAAGAGGAAGCTGGA AGG Intergenic
No off target data available for this crispr