ID: 1034702669

View in Genome Browser
Species Human (GRCh38)
Location 7:153109870-153109892
Sequence CAGGGTTTTTAATGTGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034702669_1034702675 20 Left 1034702669 7:153109870-153109892 CCTGAAACACATTAAAAACCCTG No data
Right 1034702675 7:153109913-153109935 TTTTGATGTTAGCATACGGCTGG No data
1034702669_1034702670 -9 Left 1034702669 7:153109870-153109892 CCTGAAACACATTAAAAACCCTG No data
Right 1034702670 7:153109884-153109906 AAAACCCTGCAGCAGCCTACAGG No data
1034702669_1034702674 16 Left 1034702669 7:153109870-153109892 CCTGAAACACATTAAAAACCCTG No data
Right 1034702674 7:153109909-153109931 TTACTTTTGATGTTAGCATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034702669 Original CRISPR CAGGGTTTTTAATGTGTTTC AGG (reversed) Intergenic
No off target data available for this crispr