ID: 1034703111

View in Genome Browser
Species Human (GRCh38)
Location 7:153113901-153113923
Sequence CACTTCCCAGTGAAGTGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034703107_1034703111 -6 Left 1034703107 7:153113884-153113906 CCCTGGCCTGTTGGTGTCACTTC No data
Right 1034703111 7:153113901-153113923 CACTTCCCAGTGAAGTGCTAGGG No data
1034703097_1034703111 28 Left 1034703097 7:153113850-153113872 CCCTCCCTTTGCTCCCCAGATTT No data
Right 1034703111 7:153113901-153113923 CACTTCCCAGTGAAGTGCTAGGG No data
1034703104_1034703111 13 Left 1034703104 7:153113865-153113887 CCAGATTTTCAGGAATATGCCCT No data
Right 1034703111 7:153113901-153113923 CACTTCCCAGTGAAGTGCTAGGG No data
1034703099_1034703111 24 Left 1034703099 7:153113854-153113876 CCCTTTGCTCCCCAGATTTTCAG No data
Right 1034703111 7:153113901-153113923 CACTTCCCAGTGAAGTGCTAGGG No data
1034703108_1034703111 -7 Left 1034703108 7:153113885-153113907 CCTGGCCTGTTGGTGTCACTTCC No data
Right 1034703111 7:153113901-153113923 CACTTCCCAGTGAAGTGCTAGGG No data
1034703098_1034703111 27 Left 1034703098 7:153113851-153113873 CCTCCCTTTGCTCCCCAGATTTT No data
Right 1034703111 7:153113901-153113923 CACTTCCCAGTGAAGTGCTAGGG No data
1034703103_1034703111 14 Left 1034703103 7:153113864-153113886 CCCAGATTTTCAGGAATATGCCC No data
Right 1034703111 7:153113901-153113923 CACTTCCCAGTGAAGTGCTAGGG No data
1034703100_1034703111 23 Left 1034703100 7:153113855-153113877 CCTTTGCTCCCCAGATTTTCAGG No data
Right 1034703111 7:153113901-153113923 CACTTCCCAGTGAAGTGCTAGGG No data
1034703102_1034703111 15 Left 1034703102 7:153113863-153113885 CCCCAGATTTTCAGGAATATGCC No data
Right 1034703111 7:153113901-153113923 CACTTCCCAGTGAAGTGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034703111 Original CRISPR CACTTCCCAGTGAAGTGCTA GGG Intergenic
No off target data available for this crispr