ID: 1034711298

View in Genome Browser
Species Human (GRCh38)
Location 7:153193561-153193583
Sequence GGATGCTTGTCTGTAATACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034711298_1034711302 9 Left 1034711298 7:153193561-153193583 CCAAGTATTACAGACAAGCATCC No data
Right 1034711302 7:153193593-153193615 GGTAATCACGTGTTCTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034711298 Original CRISPR GGATGCTTGTCTGTAATACT TGG (reversed) Intergenic
No off target data available for this crispr