ID: 1034711302

View in Genome Browser
Species Human (GRCh38)
Location 7:153193593-153193615
Sequence GGTAATCACGTGTTCTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034711296_1034711302 20 Left 1034711296 7:153193550-153193572 CCTTACCAGCTCCAAGTATTACA No data
Right 1034711302 7:153193593-153193615 GGTAATCACGTGTTCTACAAAGG No data
1034711295_1034711302 21 Left 1034711295 7:153193549-153193571 CCCTTACCAGCTCCAAGTATTAC No data
Right 1034711302 7:153193593-153193615 GGTAATCACGTGTTCTACAAAGG No data
1034711298_1034711302 9 Left 1034711298 7:153193561-153193583 CCAAGTATTACAGACAAGCATCC No data
Right 1034711302 7:153193593-153193615 GGTAATCACGTGTTCTACAAAGG No data
1034711297_1034711302 15 Left 1034711297 7:153193555-153193577 CCAGCTCCAAGTATTACAGACAA No data
Right 1034711302 7:153193593-153193615 GGTAATCACGTGTTCTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034711302 Original CRISPR GGTAATCACGTGTTCTACAA AGG Intergenic
No off target data available for this crispr