ID: 1034712194

View in Genome Browser
Species Human (GRCh38)
Location 7:153203515-153203537
Sequence GGGCAGAAGCAGAGGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034712187_1034712194 -1 Left 1034712187 7:153203493-153203515 CCTTCAGATGGCCTGTGTACCTG No data
Right 1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034712194 Original CRISPR GGGCAGAAGCAGAGGGAGCA AGG Intergenic
No off target data available for this crispr