ID: 1034716881

View in Genome Browser
Species Human (GRCh38)
Location 7:153251665-153251687
Sequence CCGTCTCCACTCCCATTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034716881_1034716888 29 Left 1034716881 7:153251665-153251687 CCTCATAATGGGAGTGGAGACGG No data
Right 1034716888 7:153251717-153251739 CTCTGATCTGGGTGCTCTCTTGG No data
1034716881_1034716884 -6 Left 1034716881 7:153251665-153251687 CCTCATAATGGGAGTGGAGACGG No data
Right 1034716884 7:153251682-153251704 AGACGGGCTTCTAGCTTGCTTGG No data
1034716881_1034716887 18 Left 1034716881 7:153251665-153251687 CCTCATAATGGGAGTGGAGACGG No data
Right 1034716887 7:153251706-153251728 CAGGATCTTCACTCTGATCTGGG No data
1034716881_1034716886 17 Left 1034716881 7:153251665-153251687 CCTCATAATGGGAGTGGAGACGG No data
Right 1034716886 7:153251705-153251727 ACAGGATCTTCACTCTGATCTGG No data
1034716881_1034716885 -1 Left 1034716881 7:153251665-153251687 CCTCATAATGGGAGTGGAGACGG No data
Right 1034716885 7:153251687-153251709 GGCTTCTAGCTTGCTTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034716881 Original CRISPR CCGTCTCCACTCCCATTATG AGG (reversed) Intergenic
No off target data available for this crispr