ID: 1034716885 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:153251687-153251709 |
Sequence | GGCTTCTAGCTTGCTTGGAC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1034716881_1034716885 | -1 | Left | 1034716881 | 7:153251665-153251687 | CCTCATAATGGGAGTGGAGACGG | No data | ||
Right | 1034716885 | 7:153251687-153251709 | GGCTTCTAGCTTGCTTGGACAGG | No data | ||||
1034716880_1034716885 | 0 | Left | 1034716880 | 7:153251664-153251686 | CCCTCATAATGGGAGTGGAGACG | No data | ||
Right | 1034716885 | 7:153251687-153251709 | GGCTTCTAGCTTGCTTGGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1034716885 | Original CRISPR | GGCTTCTAGCTTGCTTGGAC AGG | Intergenic | ||