ID: 1034716886

View in Genome Browser
Species Human (GRCh38)
Location 7:153251705-153251727
Sequence ACAGGATCTTCACTCTGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034716881_1034716886 17 Left 1034716881 7:153251665-153251687 CCTCATAATGGGAGTGGAGACGG No data
Right 1034716886 7:153251705-153251727 ACAGGATCTTCACTCTGATCTGG No data
1034716880_1034716886 18 Left 1034716880 7:153251664-153251686 CCCTCATAATGGGAGTGGAGACG No data
Right 1034716886 7:153251705-153251727 ACAGGATCTTCACTCTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034716886 Original CRISPR ACAGGATCTTCACTCTGATC TGG Intergenic