ID: 1034716887

View in Genome Browser
Species Human (GRCh38)
Location 7:153251706-153251728
Sequence CAGGATCTTCACTCTGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034716881_1034716887 18 Left 1034716881 7:153251665-153251687 CCTCATAATGGGAGTGGAGACGG No data
Right 1034716887 7:153251706-153251728 CAGGATCTTCACTCTGATCTGGG No data
1034716880_1034716887 19 Left 1034716880 7:153251664-153251686 CCCTCATAATGGGAGTGGAGACG No data
Right 1034716887 7:153251706-153251728 CAGGATCTTCACTCTGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034716887 Original CRISPR CAGGATCTTCACTCTGATCT GGG Intergenic
No off target data available for this crispr