ID: 1034716888

View in Genome Browser
Species Human (GRCh38)
Location 7:153251717-153251739
Sequence CTCTGATCTGGGTGCTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034716880_1034716888 30 Left 1034716880 7:153251664-153251686 CCCTCATAATGGGAGTGGAGACG No data
Right 1034716888 7:153251717-153251739 CTCTGATCTGGGTGCTCTCTTGG No data
1034716881_1034716888 29 Left 1034716881 7:153251665-153251687 CCTCATAATGGGAGTGGAGACGG No data
Right 1034716888 7:153251717-153251739 CTCTGATCTGGGTGCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034716888 Original CRISPR CTCTGATCTGGGTGCTCTCT TGG Intergenic