ID: 1034717738

View in Genome Browser
Species Human (GRCh38)
Location 7:153259130-153259152
Sequence CTAAGTTTGTAGAAGTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034717738_1034717744 9 Left 1034717738 7:153259130-153259152 CCCTCATACTTCTACAAACTTAG No data
Right 1034717744 7:153259162-153259184 GGAGTAGGTACTTTGGTGACTGG No data
1034717738_1034717743 2 Left 1034717738 7:153259130-153259152 CCCTCATACTTCTACAAACTTAG No data
Right 1034717743 7:153259155-153259177 CACTCTTGGAGTAGGTACTTTGG No data
1034717738_1034717742 -6 Left 1034717738 7:153259130-153259152 CCCTCATACTTCTACAAACTTAG No data
Right 1034717742 7:153259147-153259169 ACTTAGGACACTCTTGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034717738 Original CRISPR CTAAGTTTGTAGAAGTATGA GGG (reversed) Intergenic
No off target data available for this crispr