ID: 1034718348

View in Genome Browser
Species Human (GRCh38)
Location 7:153264341-153264363
Sequence CCACATGGAGAATCTCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034718348_1034718354 6 Left 1034718348 7:153264341-153264363 CCTAGCAGAGATTCTCCATGTGG No data
Right 1034718354 7:153264370-153264392 CACAGCTGCAAACTTATGCCTGG No data
1034718348_1034718355 15 Left 1034718348 7:153264341-153264363 CCTAGCAGAGATTCTCCATGTGG No data
Right 1034718355 7:153264379-153264401 AAACTTATGCCTGGACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034718348 Original CRISPR CCACATGGAGAATCTCTGCT AGG (reversed) Intergenic
No off target data available for this crispr