ID: 1034721359

View in Genome Browser
Species Human (GRCh38)
Location 7:153296710-153296732
Sequence TGGCACAATAATCATTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034721359_1034721366 -2 Left 1034721359 7:153296710-153296732 CCTACCCAATGATTATTGTGCCA No data
Right 1034721366 7:153296731-153296753 CACCTTACGGGGTTTTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034721359 Original CRISPR TGGCACAATAATCATTGGGT AGG (reversed) Intergenic
No off target data available for this crispr