ID: 1034727178

View in Genome Browser
Species Human (GRCh38)
Location 7:153347657-153347679
Sequence GTTACTTACGTAGTTACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034727178_1034727179 -7 Left 1034727178 7:153347657-153347679 CCTTGAGTAACTACGTAAGTAAC No data
Right 1034727179 7:153347673-153347695 AAGTAACTACGTAAATTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034727178 Original CRISPR GTTACTTACGTAGTTACTCA AGG (reversed) Intergenic