ID: 1034727465

View in Genome Browser
Species Human (GRCh38)
Location 7:153351026-153351048
Sequence TCTGAAAGGTAGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034727465_1034727473 17 Left 1034727465 7:153351026-153351048 CCTTCTCCCCTCTACCTTTCAGA No data
Right 1034727473 7:153351066-153351088 GATGTACTTAGTGGAAAAATAGG No data
1034727465_1034727472 8 Left 1034727465 7:153351026-153351048 CCTTCTCCCCTCTACCTTTCAGA No data
Right 1034727472 7:153351057-153351079 GGGTTTTTAGATGTACTTAGTGG No data
1034727465_1034727474 18 Left 1034727465 7:153351026-153351048 CCTTCTCCCCTCTACCTTTCAGA No data
Right 1034727474 7:153351067-153351089 ATGTACTTAGTGGAAAAATAGGG No data
1034727465_1034727475 19 Left 1034727465 7:153351026-153351048 CCTTCTCCCCTCTACCTTTCAGA No data
Right 1034727475 7:153351068-153351090 TGTACTTAGTGGAAAAATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034727465 Original CRISPR TCTGAAAGGTAGAGGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr