ID: 1034730499

View in Genome Browser
Species Human (GRCh38)
Location 7:153382995-153383017
Sequence GTTTGGCGGTGCTTCTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034730499_1034730502 -6 Left 1034730499 7:153382995-153383017 CCAAGTCAGAAGCACCGCCAAAC No data
Right 1034730502 7:153383012-153383034 CCAAACGCACCTCGAACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034730499 Original CRISPR GTTTGGCGGTGCTTCTGACT TGG (reversed) Intergenic
No off target data available for this crispr