ID: 1034731608

View in Genome Browser
Species Human (GRCh38)
Location 7:153392034-153392056
Sequence TCTTGTGTACTTAAGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034731606_1034731608 -9 Left 1034731606 7:153392020-153392042 CCAAAAAACAGGGTTCTTGTGTA No data
Right 1034731608 7:153392034-153392056 TCTTGTGTACTTAAGGAACATGG No data
1034731603_1034731608 5 Left 1034731603 7:153392006-153392028 CCAGCAGTAGCTGGCCAAAAAAC No data
Right 1034731608 7:153392034-153392056 TCTTGTGTACTTAAGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034731608 Original CRISPR TCTTGTGTACTTAAGGAACA TGG Intergenic
No off target data available for this crispr