ID: 1034733451

View in Genome Browser
Species Human (GRCh38)
Location 7:153408443-153408465
Sequence ATCAAATAGAAGGCAGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034733451_1034733454 -2 Left 1034733451 7:153408443-153408465 CCTTTTCCTGCCTTCTATTTGAT No data
Right 1034733454 7:153408464-153408486 ATTACTTGAGTACTTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034733451 Original CRISPR ATCAAATAGAAGGCAGGAAA AGG (reversed) Intergenic
No off target data available for this crispr