ID: 1034733465

View in Genome Browser
Species Human (GRCh38)
Location 7:153408659-153408681
Sequence GTCTAACAACAGTGGCACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034733465_1034733468 -1 Left 1034733465 7:153408659-153408681 CCTTTGTGCCACTGTTGTTAGAC No data
Right 1034733468 7:153408681-153408703 CATTTTGCTTTTACATGTGGTGG No data
1034733465_1034733469 27 Left 1034733465 7:153408659-153408681 CCTTTGTGCCACTGTTGTTAGAC No data
Right 1034733469 7:153408709-153408731 AAATATGTCCTCTCAAAAGATGG No data
1034733465_1034733467 -4 Left 1034733465 7:153408659-153408681 CCTTTGTGCCACTGTTGTTAGAC No data
Right 1034733467 7:153408678-153408700 AGACATTTTGCTTTTACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034733465 Original CRISPR GTCTAACAACAGTGGCACAA AGG (reversed) Intergenic
No off target data available for this crispr