ID: 1034734239

View in Genome Browser
Species Human (GRCh38)
Location 7:153413657-153413679
Sequence TCGTCCGGTTACTTGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 2, 2: 2, 3: 3, 4: 22}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034734239_1034734248 26 Left 1034734239 7:153413657-153413679 CCTGGCAGCAAGTAACCGGACGA 0: 1
1: 2
2: 2
3: 3
4: 22
Right 1034734248 7:153413706-153413728 GCCTGACCTGACTGAGGGAGAGG No data
1034734239_1034734243 -4 Left 1034734239 7:153413657-153413679 CCTGGCAGCAAGTAACCGGACGA 0: 1
1: 2
2: 2
3: 3
4: 22
Right 1034734243 7:153413676-153413698 ACGAAATGGACAGATGGCCGTGG 0: 1
1: 1
2: 1
3: 3
4: 72
1034734239_1034734244 -1 Left 1034734239 7:153413657-153413679 CCTGGCAGCAAGTAACCGGACGA 0: 1
1: 2
2: 2
3: 3
4: 22
Right 1034734244 7:153413679-153413701 AAATGGACAGATGGCCGTGGAGG 0: 1
1: 1
2: 1
3: 22
4: 231
1034734239_1034734246 20 Left 1034734239 7:153413657-153413679 CCTGGCAGCAAGTAACCGGACGA 0: 1
1: 2
2: 2
3: 3
4: 22
Right 1034734246 7:153413700-153413722 GGAGAAGCCTGACCTGACTGAGG No data
1034734239_1034734247 21 Left 1034734239 7:153413657-153413679 CCTGGCAGCAAGTAACCGGACGA 0: 1
1: 2
2: 2
3: 3
4: 22
Right 1034734247 7:153413701-153413723 GAGAAGCCTGACCTGACTGAGGG No data
1034734239_1034734241 -10 Left 1034734239 7:153413657-153413679 CCTGGCAGCAAGTAACCGGACGA 0: 1
1: 2
2: 2
3: 3
4: 22
Right 1034734241 7:153413670-153413692 AACCGGACGAAATGGACAGATGG 0: 1
1: 2
2: 0
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034734239 Original CRISPR TCGTCCGGTTACTTGCTGCC AGG (reversed) Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906556926 1:46721545-46721567 TTGTACTATTACTTGCTGCCTGG - Intergenic
912519117 1:110233425-110233447 TCACCAGGTTACTTGCTGACAGG - Exonic
918367292 1:183821782-183821804 TTGTCTGGTTACTTGCTTCTCGG + Intronic
1072260030 10:93660884-93660906 TCATCCTCTGACTTGCTGCCAGG + Intronic
1076761206 10:132606630-132606652 TCCTCCGTTCACTTGCTGACGGG - Intronic
1077836005 11:5928878-5928900 TCGTTCGGTTACTTGCCACCAGG + Intronic
1095186090 12:39201532-39201554 TCGTGGGGTTTCCTGCTGCCAGG - Intergenic
1107391592 13:39970454-39970476 TCCTCTGGTTACATGCTCCCCGG - Intergenic
1121496384 14:94394334-94394356 CCCTCCGGTTACTTGCAGCCTGG - Intergenic
1130272610 15:82459896-82459918 TCTTATGGTCACTTGCTGCCAGG + Intergenic
1130587252 15:85191863-85191885 TCTTATGGTCACTTGCTGCCAGG + Intergenic
1153722650 18:7922517-7922539 TTTTCCGGTTACTTTCTGCTGGG + Intronic
1166321497 19:42021946-42021968 GCGTCCTGTTTCTGGCTGCCAGG - Exonic
1168069577 19:53942243-53942265 TGGTCCGGGTACTTGATGGCGGG - Exonic
932049912 2:68388193-68388215 TCCTCCTTTTACTTGCTTCCGGG - Intronic
933560356 2:83878868-83878890 TCGTCCGGTTACTTGCCGCCAGG - Intergenic
1172979200 20:38928122-38928144 TGGTCAGGTTGCTTGCTGACTGG + Intronic
956148960 3:66221234-66221256 TCCTCGGGTTACTGGCAGCCAGG + Intronic
1005900437 6:30212992-30213014 CCGTCCGGTTGCTTGGAGCCTGG - Intronic
1019049083 6:169169607-169169629 TCCTCCTATTACCTGCTGCCCGG - Intergenic
1021171077 7:17398623-17398645 TCATCCCCTTACTTGCTGCCAGG + Intergenic
1025806712 7:64839663-64839685 TCGTCCGGTTACTTGCCGCCAGG - Intergenic
1034734239 7:153413657-153413679 TCGTCCGGTTACTTGCTGCCAGG - Intergenic
1047684698 8:127293141-127293163 TGGTCCTGTTGCTTGCTGCTTGG + Intergenic
1049214519 8:141401647-141401669 CCTTCCGGTGACTTCCTGCCAGG - Intronic
1050191794 9:3034162-3034184 TCTTCCTGCTGCTTGCTGCCGGG - Intergenic
1057483528 9:95463822-95463844 GCCTCTGGTGACTTGCTGCCTGG - Intronic
1201769988 Y:17610200-17610222 TAGTCCGGTTACTTGCCGCCAGG + Intergenic
1201831566 Y:18295787-18295809 TAGTCCGGTTACTTGCCGCCAGG - Intergenic