ID: 1034734572

View in Genome Browser
Species Human (GRCh38)
Location 7:153416552-153416574
Sequence CTGGATCCTGAATATTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034734572_1034734577 25 Left 1034734572 7:153416552-153416574 CCATTCCAATATTCAGGATCCAG No data
Right 1034734577 7:153416600-153416622 TGAACAGAAGATGTTCCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034734572 Original CRISPR CTGGATCCTGAATATTGGAA TGG (reversed) Intergenic
No off target data available for this crispr