ID: 1034737031

View in Genome Browser
Species Human (GRCh38)
Location 7:153439057-153439079
Sequence CCCCTTCCCTCTCTTTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034737028_1034737031 1 Left 1034737028 7:153439033-153439055 CCGGTGTTTGTGAGATGCCGCTC No data
Right 1034737031 7:153439057-153439079 CCCCTTCCCTCTCTTTGCTGTGG No data
1034737027_1034737031 2 Left 1034737027 7:153439032-153439054 CCCGGTGTTTGTGAGATGCCGCT No data
Right 1034737031 7:153439057-153439079 CCCCTTCCCTCTCTTTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034737031 Original CRISPR CCCCTTCCCTCTCTTTGCTG TGG Intergenic
No off target data available for this crispr