ID: 1034741001

View in Genome Browser
Species Human (GRCh38)
Location 7:153473199-153473221
Sequence GCTGCTCTTCAGACTCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034740998_1034741001 28 Left 1034740998 7:153473148-153473170 CCTGGTGGCCTTCAAACTGGGGC No data
Right 1034741001 7:153473199-153473221 GCTGCTCTTCAGACTCAGACTGG No data
1034741000_1034741001 -5 Left 1034741000 7:153473181-153473203 CCTTTTTCTACAGCAGCTGCTGC No data
Right 1034741001 7:153473199-153473221 GCTGCTCTTCAGACTCAGACTGG No data
1034740999_1034741001 20 Left 1034740999 7:153473156-153473178 CCTTCAAACTGGGGCATCAGCTC No data
Right 1034741001 7:153473199-153473221 GCTGCTCTTCAGACTCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034741001 Original CRISPR GCTGCTCTTCAGACTCAGAC TGG Intergenic
No off target data available for this crispr