ID: 1034741296

View in Genome Browser
Species Human (GRCh38)
Location 7:153475967-153475989
Sequence CTCTAGAGACAGTTTGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034741293_1034741296 6 Left 1034741293 7:153475938-153475960 CCTGTATCTCAGACTGGACACAA No data
Right 1034741296 7:153475967-153475989 CTCTAGAGACAGTTTGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034741296 Original CRISPR CTCTAGAGACAGTTTGGACT TGG Intergenic
No off target data available for this crispr