ID: 1034743481

View in Genome Browser
Species Human (GRCh38)
Location 7:153500255-153500277
Sequence ACTGATATCCAGAATCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034743481_1034743482 -9 Left 1034743481 7:153500255-153500277 CCTTGCAGATTCTGGATATCAGT No data
Right 1034743482 7:153500269-153500291 GATATCAGTTCTTTGTCAGATGG No data
1034743481_1034743483 -3 Left 1034743481 7:153500255-153500277 CCTTGCAGATTCTGGATATCAGT No data
Right 1034743483 7:153500275-153500297 AGTTCTTTGTCAGATGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034743481 Original CRISPR ACTGATATCCAGAATCTGCA AGG (reversed) Intergenic
No off target data available for this crispr