ID: 1034746600

View in Genome Browser
Species Human (GRCh38)
Location 7:153528903-153528925
Sequence GCTTAGTACTTACTTGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034746597_1034746600 10 Left 1034746597 7:153528870-153528892 CCAAACAACTTAGCAAACACCTA No data
Right 1034746600 7:153528903-153528925 GCTTAGTACTTACTTGTTACAGG No data
1034746598_1034746600 -9 Left 1034746598 7:153528889-153528911 CCTATGCCTTAATAGCTTAGTAC No data
Right 1034746600 7:153528903-153528925 GCTTAGTACTTACTTGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034746600 Original CRISPR GCTTAGTACTTACTTGTTAC AGG Intergenic
No off target data available for this crispr