ID: 1034752888

View in Genome Browser
Species Human (GRCh38)
Location 7:153587367-153587389
Sequence GGCACAGATGTGCCTCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034752879_1034752888 12 Left 1034752879 7:153587332-153587354 CCCGTGAGTTATCTTGGGGACTT No data
Right 1034752888 7:153587367-153587389 GGCACAGATGTGCCTCTGGCTGG No data
1034752878_1034752888 13 Left 1034752878 7:153587331-153587353 CCCCGTGAGTTATCTTGGGGACT No data
Right 1034752888 7:153587367-153587389 GGCACAGATGTGCCTCTGGCTGG No data
1034752874_1034752888 29 Left 1034752874 7:153587315-153587337 CCACTAAGGGTGGGTTCCCCGTG No data
Right 1034752888 7:153587367-153587389 GGCACAGATGTGCCTCTGGCTGG No data
1034752880_1034752888 11 Left 1034752880 7:153587333-153587355 CCGTGAGTTATCTTGGGGACTTG No data
Right 1034752888 7:153587367-153587389 GGCACAGATGTGCCTCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034752888 Original CRISPR GGCACAGATGTGCCTCTGGC TGG Intergenic
No off target data available for this crispr