ID: 1034756101

View in Genome Browser
Species Human (GRCh38)
Location 7:153621229-153621251
Sequence GCTGGGCTGCTAAGTATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034756101_1034756105 5 Left 1034756101 7:153621229-153621251 CCCTTTATACTTAGCAGCCCAGC No data
Right 1034756105 7:153621257-153621279 TCACCTACAGCCAGCATTGTTGG No data
1034756101_1034756106 6 Left 1034756101 7:153621229-153621251 CCCTTTATACTTAGCAGCCCAGC No data
Right 1034756106 7:153621258-153621280 CACCTACAGCCAGCATTGTTGGG No data
1034756101_1034756109 26 Left 1034756101 7:153621229-153621251 CCCTTTATACTTAGCAGCCCAGC No data
Right 1034756109 7:153621278-153621300 GGGATATCATTTTGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034756101 Original CRISPR GCTGGGCTGCTAAGTATAAA GGG (reversed) Intergenic
No off target data available for this crispr