ID: 1034756103

View in Genome Browser
Species Human (GRCh38)
Location 7:153621246-153621268
Sequence GGCTGTAGGTGAGAACTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034756103_1034756109 9 Left 1034756103 7:153621246-153621268 CCCAGCAGTTCTCACCTACAGCC No data
Right 1034756109 7:153621278-153621300 GGGATATCATTTTGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034756103 Original CRISPR GGCTGTAGGTGAGAACTGCT GGG (reversed) Intergenic
No off target data available for this crispr