ID: 1034756104

View in Genome Browser
Species Human (GRCh38)
Location 7:153621247-153621269
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034756104_1034756109 8 Left 1034756104 7:153621247-153621269 CCAGCAGTTCTCACCTACAGCCA No data
Right 1034756109 7:153621278-153621300 GGGATATCATTTTGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034756104 Original CRISPR TGGCTGTAGGTGAGAACTGC TGG (reversed) Intergenic
No off target data available for this crispr