ID: 1034756105

View in Genome Browser
Species Human (GRCh38)
Location 7:153621257-153621279
Sequence TCACCTACAGCCAGCATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034756102_1034756105 4 Left 1034756102 7:153621230-153621252 CCTTTATACTTAGCAGCCCAGCA No data
Right 1034756105 7:153621257-153621279 TCACCTACAGCCAGCATTGTTGG No data
1034756101_1034756105 5 Left 1034756101 7:153621229-153621251 CCCTTTATACTTAGCAGCCCAGC No data
Right 1034756105 7:153621257-153621279 TCACCTACAGCCAGCATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034756105 Original CRISPR TCACCTACAGCCAGCATTGT TGG Intergenic
No off target data available for this crispr