ID: 1034756107

View in Genome Browser
Species Human (GRCh38)
Location 7:153621260-153621282
Sequence ATCCCAACAATGCTGGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034756107_1034756109 -5 Left 1034756107 7:153621260-153621282 CCTACAGCCAGCATTGTTGGGAT No data
Right 1034756109 7:153621278-153621300 GGGATATCATTTTGTTTCCATGG No data
1034756107_1034756112 19 Left 1034756107 7:153621260-153621282 CCTACAGCCAGCATTGTTGGGAT No data
Right 1034756112 7:153621302-153621324 ATTGCCCAGATGAATTGTCTGGG No data
1034756107_1034756115 28 Left 1034756107 7:153621260-153621282 CCTACAGCCAGCATTGTTGGGAT No data
Right 1034756115 7:153621311-153621333 ATGAATTGTCTGGGCAATGCAGG No data
1034756107_1034756111 18 Left 1034756107 7:153621260-153621282 CCTACAGCCAGCATTGTTGGGAT No data
Right 1034756111 7:153621301-153621323 CATTGCCCAGATGAATTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034756107 Original CRISPR ATCCCAACAATGCTGGCTGT AGG (reversed) Intergenic
No off target data available for this crispr