ID: 1034756108

View in Genome Browser
Species Human (GRCh38)
Location 7:153621267-153621289
Sequence AAATGATATCCCAACAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034756108_1034756112 12 Left 1034756108 7:153621267-153621289 CCAGCATTGTTGGGATATCATTT No data
Right 1034756112 7:153621302-153621324 ATTGCCCAGATGAATTGTCTGGG No data
1034756108_1034756115 21 Left 1034756108 7:153621267-153621289 CCAGCATTGTTGGGATATCATTT No data
Right 1034756115 7:153621311-153621333 ATGAATTGTCTGGGCAATGCAGG No data
1034756108_1034756111 11 Left 1034756108 7:153621267-153621289 CCAGCATTGTTGGGATATCATTT No data
Right 1034756111 7:153621301-153621323 CATTGCCCAGATGAATTGTCTGG No data
1034756108_1034756116 26 Left 1034756108 7:153621267-153621289 CCAGCATTGTTGGGATATCATTT No data
Right 1034756116 7:153621316-153621338 TTGTCTGGGCAATGCAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034756108 Original CRISPR AAATGATATCCCAACAATGC TGG (reversed) Intergenic
No off target data available for this crispr