ID: 1034756109

View in Genome Browser
Species Human (GRCh38)
Location 7:153621278-153621300
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034756107_1034756109 -5 Left 1034756107 7:153621260-153621282 CCTACAGCCAGCATTGTTGGGAT No data
Right 1034756109 7:153621278-153621300 GGGATATCATTTTGTTTCCATGG No data
1034756101_1034756109 26 Left 1034756101 7:153621229-153621251 CCCTTTATACTTAGCAGCCCAGC No data
Right 1034756109 7:153621278-153621300 GGGATATCATTTTGTTTCCATGG No data
1034756104_1034756109 8 Left 1034756104 7:153621247-153621269 CCAGCAGTTCTCACCTACAGCCA No data
Right 1034756109 7:153621278-153621300 GGGATATCATTTTGTTTCCATGG No data
1034756102_1034756109 25 Left 1034756102 7:153621230-153621252 CCTTTATACTTAGCAGCCCAGCA No data
Right 1034756109 7:153621278-153621300 GGGATATCATTTTGTTTCCATGG No data
1034756103_1034756109 9 Left 1034756103 7:153621246-153621268 CCCAGCAGTTCTCACCTACAGCC No data
Right 1034756109 7:153621278-153621300 GGGATATCATTTTGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034756109 Original CRISPR GGGATATCATTTTGTTTCCA TGG Intergenic