ID: 1034756110

View in Genome Browser
Species Human (GRCh38)
Location 7:153621295-153621317
Sequence AATTCATCTGGGCAATGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034756110_1034756116 -2 Left 1034756110 7:153621295-153621317 CCATGGCATTGCCCAGATGAATT No data
Right 1034756116 7:153621316-153621338 TTGTCTGGGCAATGCAGGAGTGG No data
1034756110_1034756115 -7 Left 1034756110 7:153621295-153621317 CCATGGCATTGCCCAGATGAATT No data
Right 1034756115 7:153621311-153621333 ATGAATTGTCTGGGCAATGCAGG No data
1034756110_1034756117 26 Left 1034756110 7:153621295-153621317 CCATGGCATTGCCCAGATGAATT No data
Right 1034756117 7:153621344-153621366 AATTAACTATCAAGAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034756110 Original CRISPR AATTCATCTGGGCAATGCCA TGG (reversed) Intergenic
No off target data available for this crispr