ID: 1034756111

View in Genome Browser
Species Human (GRCh38)
Location 7:153621301-153621323
Sequence CATTGCCCAGATGAATTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034756108_1034756111 11 Left 1034756108 7:153621267-153621289 CCAGCATTGTTGGGATATCATTT No data
Right 1034756111 7:153621301-153621323 CATTGCCCAGATGAATTGTCTGG No data
1034756107_1034756111 18 Left 1034756107 7:153621260-153621282 CCTACAGCCAGCATTGTTGGGAT No data
Right 1034756111 7:153621301-153621323 CATTGCCCAGATGAATTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034756111 Original CRISPR CATTGCCCAGATGAATTGTC TGG Intergenic
No off target data available for this crispr