ID: 1034756115

View in Genome Browser
Species Human (GRCh38)
Location 7:153621311-153621333
Sequence ATGAATTGTCTGGGCAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034756107_1034756115 28 Left 1034756107 7:153621260-153621282 CCTACAGCCAGCATTGTTGGGAT No data
Right 1034756115 7:153621311-153621333 ATGAATTGTCTGGGCAATGCAGG No data
1034756108_1034756115 21 Left 1034756108 7:153621267-153621289 CCAGCATTGTTGGGATATCATTT No data
Right 1034756115 7:153621311-153621333 ATGAATTGTCTGGGCAATGCAGG No data
1034756110_1034756115 -7 Left 1034756110 7:153621295-153621317 CCATGGCATTGCCCAGATGAATT No data
Right 1034756115 7:153621311-153621333 ATGAATTGTCTGGGCAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034756115 Original CRISPR ATGAATTGTCTGGGCAATGC AGG Intergenic
No off target data available for this crispr