ID: 1034760772

View in Genome Browser
Species Human (GRCh38)
Location 7:153669676-153669698
Sequence CTCAGCAGCAGTTTCTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034760769_1034760772 10 Left 1034760769 7:153669643-153669665 CCACTGTGAAAATCCTTGTGTGC No data
Right 1034760772 7:153669676-153669698 CTCAGCAGCAGTTTCTCAGAGGG No data
1034760770_1034760772 -3 Left 1034760770 7:153669656-153669678 CCTTGTGTGCTTAATCTTGTCTC No data
Right 1034760772 7:153669676-153669698 CTCAGCAGCAGTTTCTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034760772 Original CRISPR CTCAGCAGCAGTTTCTCAGA GGG Intergenic
No off target data available for this crispr