ID: 1034761024

View in Genome Browser
Species Human (GRCh38)
Location 7:153671892-153671914
Sequence CGTTTTATAGACATGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034761024_1034761030 8 Left 1034761024 7:153671892-153671914 CCCAACTCCATGTCTATAAAACG No data
Right 1034761030 7:153671923-153671945 ATTTGTTGAGTTATTAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034761024 Original CRISPR CGTTTTATAGACATGGAGTT GGG (reversed) Intergenic
No off target data available for this crispr