ID: 1034763286

View in Genome Browser
Species Human (GRCh38)
Location 7:153693942-153693964
Sequence CAGGGTTTGCCAGGGGCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034763286_1034763294 13 Left 1034763286 7:153693942-153693964 CCGACAGCCCCTGGCAAACCCTG No data
Right 1034763294 7:153693978-153694000 AGTCCAAAAGCTGAAGAACTTGG 0: 485
1: 874
2: 1047
3: 1246
4: 1341
1034763286_1034763296 29 Left 1034763286 7:153693942-153693964 CCGACAGCCCCTGGCAAACCCTG No data
Right 1034763296 7:153693994-153694016 AACTTGGAGTCTGACCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034763286 Original CRISPR CAGGGTTTGCCAGGGGCTGT CGG (reversed) Intergenic
No off target data available for this crispr