ID: 1034768492 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:153749055-153749077 |
| Sequence | AGATGGAGGCTACAGTTGGC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1034768481_1034768492 | 15 | Left | 1034768481 | 7:153749017-153749039 | CCAGCGACGGAGGGGGCTTGTGC | No data | ||
| Right | 1034768492 | 7:153749055-153749077 | AGATGGAGGCTACAGTTGGCCGG | No data | ||||
| 1034768475_1034768492 | 30 | Left | 1034768475 | 7:153749002-153749024 | CCACAAGGTAAGGGACCAGCGAC | No data | ||
| Right | 1034768492 | 7:153749055-153749077 | AGATGGAGGCTACAGTTGGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1034768492 | Original CRISPR | AGATGGAGGCTACAGTTGGC CGG | Intergenic | ||
| No off target data available for this crispr | |||||