ID: 1034768492

View in Genome Browser
Species Human (GRCh38)
Location 7:153749055-153749077
Sequence AGATGGAGGCTACAGTTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034768481_1034768492 15 Left 1034768481 7:153749017-153749039 CCAGCGACGGAGGGGGCTTGTGC No data
Right 1034768492 7:153749055-153749077 AGATGGAGGCTACAGTTGGCCGG No data
1034768475_1034768492 30 Left 1034768475 7:153749002-153749024 CCACAAGGTAAGGGACCAGCGAC No data
Right 1034768492 7:153749055-153749077 AGATGGAGGCTACAGTTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034768492 Original CRISPR AGATGGAGGCTACAGTTGGC CGG Intergenic
No off target data available for this crispr