ID: 1034768533

View in Genome Browser
Species Human (GRCh38)
Location 7:153749257-153749279
Sequence TAGGATCTCCAGCCCCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034768533_1034768544 29 Left 1034768533 7:153749257-153749279 CCACCCTGGGGCTGGAGATCCTA No data
Right 1034768544 7:153749309-153749331 AGCTGTTTCCCATGATTGCGAGG No data
1034768533_1034768538 -5 Left 1034768533 7:153749257-153749279 CCACCCTGGGGCTGGAGATCCTA No data
Right 1034768538 7:153749275-153749297 TCCTACCCTGCTTTGCGGCTGGG No data
1034768533_1034768537 -6 Left 1034768533 7:153749257-153749279 CCACCCTGGGGCTGGAGATCCTA No data
Right 1034768537 7:153749274-153749296 ATCCTACCCTGCTTTGCGGCTGG No data
1034768533_1034768536 -10 Left 1034768533 7:153749257-153749279 CCACCCTGGGGCTGGAGATCCTA No data
Right 1034768536 7:153749270-153749292 GGAGATCCTACCCTGCTTTGCGG No data
1034768533_1034768543 3 Left 1034768533 7:153749257-153749279 CCACCCTGGGGCTGGAGATCCTA No data
Right 1034768543 7:153749283-153749305 TGCTTTGCGGCTGGGCTGGCAGG No data
1034768533_1034768540 -1 Left 1034768533 7:153749257-153749279 CCACCCTGGGGCTGGAGATCCTA No data
Right 1034768540 7:153749279-153749301 ACCCTGCTTTGCGGCTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034768533 Original CRISPR TAGGATCTCCAGCCCCAGGG TGG (reversed) Intergenic